AACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.mlimage lelgenio ( @lelgenio@lemmy.ml ) Memes@lemmy.ml • 1 year ago message-square6fedilinkarrow-up1269
arrow-up1269imageAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.ml lelgenio ( @lelgenio@lemmy.ml ) Memes@lemmy.ml • 1 year ago message-square6fedilink
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
minus-square Gruxx ( @Gruxx@kbin.social ) linkfedilink12•1 year agoUgh it didn’t blast or translate EMBOSS_001_1 NVIALPVGTX EMBOSS_001_2 TSPDYQVLX EMBOSS_001_3 RHSLITSRY EMBOSS_001_4 STYW*SGYDV EMBOSS_001_5 YLLVIRLRX EMBOSS_001_6 LVPTGNQAMTX
minus-square TauZero ( @TauZero@mander.xyz ) linkfedilink2•1 year agoOut of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?
minus-square apotheotic(she/they) ( @apotheotic@beehaw.org ) linkfedilink8•1 year agoMr Krabs laughs very distinctly, and it sort of sounds like it would be spelt like the genome in the OP. Check it out on yt or something, should help
Ugh it didn’t blast or translate
Out of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?
Mr Krabs laughs very distinctly, and it sort of sounds like it would be spelt like the genome in the OP. Check it out on yt or something, should help