AACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.mlimage lelgenio ( @lelgenio@lemmy.ml ) Memes@lemmy.ml • 1 year ago message-square6fedilinkarrow-up1269
arrow-up1269imageAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.ml lelgenio ( @lelgenio@lemmy.ml ) Memes@lemmy.ml • 1 year ago message-square6fedilink
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
minus-square TauZero ( @TauZero@mander.xyz ) linkfedilink2•1 year agoOut of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?
minus-square apotheotic(she/they) ( @apotheotic@beehaw.org ) linkfedilink8•1 year agoMr Krabs laughs very distinctly, and it sort of sounds like it would be spelt like the genome in the OP. Check it out on yt or something, should help
Out of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?
Mr Krabs laughs very distinctly, and it sort of sounds like it would be spelt like the genome in the OP. Check it out on yt or something, should help